ENSDARG00000040067

Ensembl ID:
ENSDARG00000040067
Human Orthologue:
ENDOG
Human Description:
endonuclease G [Source:HGNC Symbol;Acc:3346]
Mouse Orthologue:
Endog
Mouse Description:
endonuclease G Gene [Source:MGI Symbol;Acc:MGI:1261433]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8106 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058600 Nonsense 69 221 2 2
Genomic Location:
Chromosome 3 (position 6737081)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATGAAAACAATCAASCTAAGACAGAACTTAAAGAAAATACTGACAGC[A/T]AGCGAGAATCCGATCAAAGAGACTTGAACCAAATGACTCGAGGTCATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sno0r56n