cx45.6

Ensembl ID:
ENSDARG00000040065
ZFIN ID:
ZDB-GENE-040407-3
Description:
connexin 45.6 [Source:RefSeq peptide;Acc:NP_001007214]
Human Orthologue:
GJA5
Human Description:
gap junction protein, alpha 5, 40kDa [Source:HGNC Symbol;Acc:4279]
Mouse Orthologue:
Gja5
Mouse Description:
gap junction protein, alpha 5 Gene [Source:MGI Symbol;Acc:MGI:95716]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21509 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058598 Nonsense 394 400 3 3
ENSDART00000128357 Nonsense 394 400 2 2
ENSDART00000133118 Nonsense 394 400 1 1
Genomic Location:
Chromosome 9 (position 31510081)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACAAGCGCCGGCTTAGCAAGACCAGTGGTACTAGTAGTAACCGACTC[A/T]GACCAAGTGATCTGGCCGTGTAGATCGTGAAAGTGGCAGTTTCTGAGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ls7plc9b