acp6

Ensembl ID:
ENSDARG00000040064
ZFIN ID:
ZDB-GENE-050208-290
Description:
lysophosphatidic acid phosphatase type 6 [Source:RefSeq peptide;Acc:NP_001103850]
Human Orthologue:
ACP6
Human Description:
acid phosphatase 6, lysophosphatidic [Source:HGNC Symbol;Acc:29609]
Mouse Orthologue:
Acp6
Mouse Description:
acid phosphatase 6, lysophosphatidic Gene [Source:MGI Symbol;Acc:MGI:1931010]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5548 Nonsense Mutation detected in F1 DNA During 2016
sa34674 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101097 Nonsense 114 405 4 11
Genomic Location:
Chromosome 9 (position 31514377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGGAACTTATCCAGGTCAGCTGACCACAATAGGCATGCAGCAGCTGTA[T/G]GATCTGGGAGTGAGGTTACGAAAGAAATACATCCAGGAGGAGCCCTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101097 Essential Splice Site 361 405 10 11
Genomic Location:
Chromosome 9 (position 31520920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACCGGCAAACTAACCAGCACTATGTAAAAGTCTCTTACATTGACCAG[G/A]TAACATACAACAAACACGCCTAGCCTAGCATACAAAACTTGTTTTTAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link