si:ch211-15e22.3

Ensembl ID:
ENSDARG00000040048
ZFIN ID:
ZDB-GENE-090312-115
Description:
polypeptide N-acetylgalactosaminyltransferase-like 6 [Source:RefSeq peptide;Acc:NP_001139074]
Human Orthologue:
GALNTL6
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6 [Source:HGNC
Mouse Orthologue:
Galnt10
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 Gene [Source:MGI

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39647 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10501 Essential Splice Site Available for shipment Available now
sa18048 Nonsense Available for shipment Available now
sa5940 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25626 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Essential Splice Site 128 600 3 12
ENSDART00000139448 Essential Splice Site 128 600 4 13
Genomic Location (Zv9):
Chromosome 1 (position 38273882)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37145338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAACAATATCGCTCTGGATCGCTCGCTTCCTGACATCCGACATCCAAA[G/T]TGAGTAGAGCTGATTCTTCACCGCCTCCAGAGCTGCACAGCTTGAGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Essential Splice Site 246 600 5 12
ENSDART00000139448 Essential Splice Site 246 600 6 13
Genomic Location (Zv9):
Chromosome 1 (position 38470186)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37341642
KASP Assay ID:
2259-0828.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATTCTCATTGTGAAGCCAACATCAACTGGCTGCCACCCTTGCTTGG[T/C]GAGTCCAGWTATACAGTATATATNAAAAAAGAAAGAAAAATACCAACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Nonsense 543 600 11 12
ENSDART00000139448 Nonsense 543 600 12 13
Genomic Location (Zv9):
Chromosome 1 (position 38535158)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37406614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACGCTCTATGACTGCCATGGCATGAAAGGCAACCAGCACTGGAGCTA[C/A]AGGAAGGYAAAGCAAATWATCTGCTTGTCAATATTTTGTGACAGAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Essential Splice Site 545 600 11 12
ENSDART00000139448 Essential Splice Site 545 600 12 13
Genomic Location (Zv9):
Chromosome 1 (position 38535166)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37406622
KASP Assay ID:
554-3851.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGACTGCCATGGCATGAAAGGCAACCAGCACTGGAGCTACAGGAAGG[T/C]AAAGCAAATWATCTGCTTGTCAATATTTTGTGACAGAAAGAATTTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Nonsense 580 600 12 12
ENSDART00000139448 Nonsense 580 600 13 13
Genomic Location (Zv9):
Chromosome 1 (position 38540458)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37411914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGATAAGCGGATTTTCATGAACAAGTGTGATCCCAAGTCTGAAACACAA[C/T]AGTGGATCTTCCAGAAAGTCAACGCCACCGTTCTGGACAAATTCAACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link