mcm4

Ensembl ID:
ENSDARG00000040041
ZFIN IDs:
ZDB-GENE-030131-9544, ZDB-GENE-030131-9544, ZDB-GENE-030131-9544
Description:
DNA replication licensing factor MCM4 [Source:RefSeq peptide;Acc:NP_944595]
Human Orthologue:
MCM4
Human Description:
minichromosome maintenance complex component 4 [Source:HGNC Symbol;Acc:6947]
Mouse Orthologue:
Mcm4
Mouse Description:
minichromosome maintenance deficient 4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:10319

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1949 Nonsense Available for shipment Available now
sa12196 Nonsense Available for shipment Available now
sa18098 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058562 Nonsense 387 750 11 18
ENSDART00000058564 Nonsense 387 845 11 17
ENSDART00000128767 Nonsense 387 845 11 17
Genomic Location:
Chromosome 24 (position 37041363)
KASP Assay ID:
554-1937.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATYGTGCTCAGGCATCTACAGAGCTGCCCCGATGCGTCTGAACCCACGG[C/T]AGAGCCAGGTGAAGTCTGTWTACAAGACCCACATTGACGCCATTCACTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa12196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058562 Nonsense 661 750 14 18
ENSDART00000058564 Nonsense 661 845 14 17
ENSDART00000128767 Nonsense 661 845 14 17
Genomic Location:
Chromosome 24 (position 37038377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGCACCACCTTGTCTCTCTGTATTATCAGAGTGAAGAGCAGATTGAA[G/T]AGGAGCATCTGGACATGGCTGTACTGAAAGACTACATCGCCTTCGCTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058562 Nonsense 696 750 15 18
ENSDART00000058564 Nonsense 696 845 15 17
ENSDART00000128767 Nonsense 696 845 15 17
Genomic Location:
Chromosome 24 (position 37035841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTAAYAGATCCAATGTCAAATGTGTAATTTTGCTCCTCACAGGCCTA[T/A]GTGGACATGCGCAAGATCGGCAGCGGTCGAGGGATGGTGTCTGCGTATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s6rqjh68