si:ch73-389o5.3

Ensembl ID:
ENSDARG00000040037
ZFIN ID:
ZDB-GENE-100922-174
Description:
Novel protein similar to vertebrate ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4) [So
Human Orthologue:
ST3GAL1
Human Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 1 [Source:HGNC Symbol;Acc:10862]
Mouse Orthologue:
St3gal1
Mouse Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:98304]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14070 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058563 Nonsense 116 170 3 4
Genomic Location (Zv9):
Chromosome 19 (position 18354894)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19200129
KASP Assay ID:
2261-3157.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCATCCACTGGTTTTATTACACTTATATTTGCCCTGCACATCTGTKAC[C/T]AGGTAATAGTTTTTAATTACTATTTTACCTGTATCTTAAATTATACCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link