trmt11

Ensembl ID:
ENSDARG00000040033
ZFIN ID:
ZDB-GENE-040426-953
Description:
tRNA guanosine-2'-O-methyltransferase TRM11 homolog [Source:RefSeq peptide;Acc:NP_956510]
Human Orthologue:
TRMT11
Human Description:
tRNA methyltransferase 11 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:21080]
Mouse Orthologue:
Trmt11
Mouse Description:
tRNA methyltransferase 11 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1920931]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2875 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2875
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102552 Nonsense 285 466 9 13
ENSDART00000125484 Nonsense 285 384 9 12

The following transcripts of ENSDARG00000040033 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 42719259)
KASP Assay ID:
554-3319.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAGAACATTCGAGCAAACTTGCGTCAGTATGGGGCTGAAAATCTCTA[T/A]GTGGACGTCATGGTGTCTGATGCCTCCAAACTGGTTTGGAGACGAAATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9tz2eo94