osbpl10

Ensembl ID:
ENSDARG00000040027
ZFIN ID:
ZDB-GENE-081002-4
Human Orthologue:
OSBPL10
Human Description:
oxysterol binding protein-like 10 [Source:HGNC Symbol;Acc:16395]
Mouse Orthologue:
Osbpl10
Mouse Description:
oxysterol binding protein-like 10 Gene [Source:MGI Symbol;Acc:MGI:1921736]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32104 Essential Splice Site Available for shipment Available now
sa28714 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043823 Essential Splice Site 156 752 4 12
ENSDART00000141801   None 677 None 11
Genomic Location (Zv9):
Chromosome 16 (position 41963779)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 39347229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGCTCTCCCCTTCACTCCTGCTTCTGCCATTGCTGCTGTCTGTTTCA[G/A]GGCTGCTCCTCCTCTTCCTCCTCCTCCACTTCATCCACCGGCCGGACCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043823 Nonsense 520 752 8 12
ENSDART00000141801 Nonsense 445 677 7 11
Genomic Location (Zv9):
Chromosome 16 (position 42028711)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 39412161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCTCCAATGAGGGCTTAGGGTCTTACCGGCTGCGTTTCGTGGCTGAA[C/T]AGGTGTCCCACCACCCGCCAGTGTCTGGATTTTACTGCGAGTGCAAAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Peripheral artery disease: Identification of evidence suggestive of an association with peripheral arterial disease at the OSBPL10 locus by genome-wide investigation in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link