si:dkey-208k4.2

Ensembl ID:
ENSDARG00000040022
ZFIN ID:
ZDB-GENE-030131-6124
Description:
transcription factor IIIA-like [Source:RefSeq peptide;Acc:NP_001093876]
Human Orthologue:
GTF3A
Human Description:
general transcription factor IIIA [Source:HGNC Symbol;Acc:4662]
Mouse Orthologue:
Gtf3a
Mouse Description:
general transcription factor III A Gene [Source:MGI Symbol;Acc:MGI:1913846]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23490 Missense, Nonsense Available for shipment Available now
sa36811 Nonsense Mutation detected in F1 DNA During 2017
sa16765 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058548 Missense 13 379 1 10
ENSDART00000104457 Nonsense 1 336 1 8
ENSDART00000104459   None 361 1 9
ENSDART00000138678 Missense 6 409 1 9
Genomic Location (Zv9):
Chromosome 19 (position 18005211)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18850446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGGTGACTGTAGCTTATAAAGGGAATCCCAATGCGGCCGGAGACTG[G/T]AATTATTGCTTAAAAAGAGAGAGAGAAAGAGAGAGAGAAAAAAAGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058548 Nonsense 355 379 9 10
ENSDART00000104457 Nonsense 275 336 8 8
ENSDART00000104459 Nonsense 300 361 9 9
ENSDART00000138678 Nonsense 348 409 9 9
Genomic Location (Zv9):
Chromosome 19 (position 18002666)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18847901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATAAGCGAAGCAGCAAGAGTTGGCAGAAACGTTTGGAAGGACGAAAT[C/T]GACGTCCTCTGGTTGAAGACCTCCATGCTCTTTTTTCTTTGCGCATGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058548   None 379 None 10
ENSDART00000104457 Nonsense 322 336 8 8
ENSDART00000104459 Nonsense 347 361 9 9
ENSDART00000138678 Nonsense 395 409 9 9
Genomic Location (Zv9):
Chromosome 19 (position 18002525)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18847760
KASP Assay ID:
2261-3141.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTAATGAGCGCAAAATCCCCCATCACATTGATCCTGAAGTAAACCTC[A/T]GAGATCTATTTGGTAGCCGATTGGCTCAGGCAAATGTGGCTGATTAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link