pnpla7

Ensembl ID:
ENSDARG00000040002
ZFIN ID:
ZDB-GENE-050309-66
Description:
Novel protein similar to vertebrate patatin-like phospholipase domain containing 7 (PNPLA7) [Source:
Human Orthologue:
PNPLA7
Human Description:
patatin-like phospholipase domain containing 7 [Source:HGNC Symbol;Acc:24768]
Mouse Orthologue:
Pnpla7
Mouse Description:
patatin-like phospholipase domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2385325]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14870 Nonsense Available for shipment Available now
sa17088 Nonsense Available for shipment Available now
sa20413 Nonsense Available for shipment Available now
sa40422 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14870
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002118 Nonsense 6 1275 1 36
ENSDART00000128179   None 316 None 9
ENSDART00000145061 Nonsense 31 1293 3 35
Genomic Location (Zv9):
Chromosome 5 (position 26739050)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24566315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCATCTGGTCAKGAAATCAAGGCTCGTGTGCAACACTTYATCGAGGAT[C/T]AGTTACACACCACCATGGTATATTACTGTAATTTATTCCCATGTGWATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002118 Nonsense 138 1275 5 36
ENSDART00000128179   None 316 None 9
ENSDART00000145061   None 1293 None 35
Genomic Location (Zv9):
Chromosome 5 (position 26735592)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24562857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACYGAATTTGATATGCAAAACTCTCATCTGCCCTCTGAAGTCCTRTA[C/A]ATGCTGAAAAATGTGAGGTTGGTACTTTGCCATGTCATCAACAAAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002118 Nonsense 639 1275 20 36
ENSDART00000128179   None 316 None 9
ENSDART00000145061 Nonsense 603 1293 18 35
Genomic Location (Zv9):
Chromosome 5 (position 26728306)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24555571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGATTGCGTTCTGTCATCATGAAGGATGATGGGAAGAAAGAGCTGGCT[G/T]GAGAGTATGGACGGGGAGACCTCATCGGTGTGGTGAGTGCTTATAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002118 Nonsense 975 1275 28 36
ENSDART00000128179   None 316 None 9
ENSDART00000145061 Nonsense 939 1293 26 35
Genomic Location (Zv9):
Chromosome 5 (position 26719266)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 24546531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGATCTGATCGGCGGCACTTCCATTGGTTCATTGATAGGAGCTCTATA[T/A]GCTGAAGAGCGTAGCGTCAGTCGCATGACGGTTAGGGCACGCCAGTGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link