fryl

Ensembl ID:
ENSDARG00000040001
ZFIN ID:
ZDB-GENE-040914-58
Description:
furry homolog-like [Source:RefSeq peptide;Acc:NP_001153139]
Human Orthologue:
FRYL
Human Description:
FRY-like [Source:HGNC Symbol;Acc:29127]
Mouse Orthologue:
Fryl
Mouse Description:
furry homolog-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1919563]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23688 Nonsense Mutation detected in F1 DNA During 2014
sa23689 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23690 Nonsense Mutation detected in F1 DNA During 2014
sa12460 Nonsense Available for shipment Available now
sa18085 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058522 Nonsense 73 3079 3 59
ENSDART00000132248 Nonsense 129 3142 4 60
ENSDART00000136922 None None 148 None 5
ENSDART00000144261 None None 182 None 6
Genomic Location:
Chromosome 20 (position 23330902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAGTTAATAAGCTCTATGAGCTCCATAGCAGAACACTGTTTGCCTT[C/A]GCTGCTGCGGACACTGTTTGACTGGTACAGACGACAGAGCGGGACAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058522 Essential Splice Site 717 3079 18 59
ENSDART00000132248 Essential Splice Site 780 3142 19 60
ENSDART00000136922 None None 148 None 5
ENSDART00000144261 None None 182 None 6
Genomic Location:
Chromosome 20 (position 23353551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTCTCAAAGAGGTCCGATCGCTGCACACGGCCCTCGGCATTGCCAAG[G/T]TAACCATCCTCCCTGCATAACTTCCTGTTATTCTCCCACATCGCATGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058522 Nonsense 1225 3079 29 59
ENSDART00000132248 Nonsense 1288 3142 30 60
ENSDART00000136922 None None 148 None 5
ENSDART00000144261 None None 182 None 6
Genomic Location:
Chromosome 20 (position 23359784)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTGAATCTCATCTTGTTTAAGGCTGCAGACTCTTCCAGAGACATCTA[T/G]GAGGTTGCAATGCAGCTATTGCAGGTCCGTGGAAATTATTATTATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058522 Nonsense 1587 3079 36 59
ENSDART00000132248 Nonsense 1650 3142 37 60
ENSDART00000136922 None None 148 None 5
ENSDART00000144261 None None 182 None 6
Genomic Location:
Chromosome 20 (position 23365994)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTWCCGTTTCCACCCACTGGCGGCTGCTGGTCACCAMTGGTCGATTACT[T/A]GCCTGAAACCACCACACCTGGAGTCTCCCTGCACAGGTAAARAACCTGCK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058522 Essential Splice Site 2701 3079 52 59
ENSDART00000132248 Essential Splice Site 2764 3142 53 60
ENSDART00000136922 None None 148 None 5
ENSDART00000144261 None None 182 None 6
Genomic Location:
Chromosome 20 (position 23390171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGACGATCGGTGCGAGGAAGAAGAGGCAGATTTTTATGGACTTTCCAG[G/A]TTGGTCTATGATTTCKGTTGCGGTMATTCATAGGGTGAATAWTTGACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xljwq6gh