LOC100006328

Ensembl ID:
ENSDARG00000039999
Human Orthologue:
SLC13A5
Human Description:
solute carrier family 13 (sodium-dependent citrate transporter), member 5 [Source:HGNC Symbol;Acc:23
Mouse Orthologue:
Slc13a5
Mouse Description:
solute carrier family 13 (sodium-dependent citrate transporter), member 5 Gene [Source:MGI Symbol;Ac

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15957 Essential Splice Site Available for shipment Available now
sa3919 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058514 Essential Splice Site 194 607 4 14
Genomic Location:
Chromosome 15 (position 25915884)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCTGAGRCGGAGTACAAACACGCGGCCAAAGACAGAGMCAGACAAGG[T/G]CAGGAGAAGARATGAAGCACATACTGTACTGTTCATATGNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058514 Nonsense 219 607 6 14
Genomic Location:
Chromosome 15 (position 25917501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCRCATGCTGGATGTTTCTCCWGAGGTCAGACAAAAGGAGCTGGCAGAG[A/T]AGCGTCATATGGCTAAAGGCATGACTCTCTGTGTTTGCTATGCTGCCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fw4i54wo