LOC100006328

Ensembl ID:
ENSDARG00000039999
Human Orthologue:
SLC13A5
Human Description:
solute carrier family 13 (sodium-dependent citrate transporter), member 5 [Source:HGNC Symbol;Acc:23
Mouse Orthologue:
Slc13a5
Mouse Description:
solute carrier family 13 (sodium-dependent citrate transporter), member 5 Gene [Source:MGI Symbol;Ac

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15957 Essential Splice Site Available for shipment Available now
sa3919 Nonsense Mutation detected in F1 DNA During 2016
sa35895 Nonsense Mutation detected in F1 DNA During 2016
sa42558 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058514 Essential Splice Site 194 607 4 14
Genomic Location:
Chromosome 15 (position 25915884)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCTGAGRCGGAGTACAAACACGCGGCCAAAGACAGAGMCAGACAAGG[T/G]CAGGAGAAGARATGAAGCACATACTGTACTGTTCATATGNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058514 Nonsense 219 607 6 14
Genomic Location:
Chromosome 15 (position 25917501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCRCATGCTGGATGTTTCTCCWGAGGTCAGACAAAAGGAGCTGGCAGAG[A/T]AGCGTCATATGGCTAAAGGCATGACTCTCTGTGTTTGCTATGCTGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058514 Nonsense 371 607 9 14
Genomic Location:
Chromosome 15 (position 25919714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATACTGTCATAATGATCTCACTTTTTTATTTTTATATTCCACACATTT[A/T]GATATGTGACAGATGCTACAGTTGCAGTCTTTATTGCTATGCTGCTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058514 Essential Splice Site 407 607 10 14
Genomic Location:
Chromosome 15 (position 25921294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTGTTACTGTCAGCTGGAACTGACTGTATACTGTATATTCATTTCC[A/C]GAATCTCAGCGTTCTTCTGCACCAGGCACAGCCCTGCTCTCCTGGAAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link