ptp4a3

Ensembl ID:
ENSDARG00000039997
ZFIN ID:
ZDB-GENE-040426-2220
Description:
protein tyrosine phosphatase type IVA 3 [Source:RefSeq peptide;Acc:NP_998346]
Human Orthologue:
PTP4A3
Human Description:
protein tyrosine phosphatase type IVA, member 3 [Source:HGNC Symbol;Acc:9636]
Mouse Orthologue:
Ptp4a3
Mouse Description:
protein tyrosine phosphatase 4a3 Gene [Source:MGI Symbol;Acc:MGI:1277098]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43286 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035538 Nonsense 148 173 5 5
Genomic Location (Zv9):
Chromosome 19 (position 25575866)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25505978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTGGCAGGAAGCGCAGAGGTGCAATAAACAGCAAGCAGCTGACGTA[T/A]CTAGAGAAATATCGGCCCAAACAGAGACTGCGCTACAAGCACCCGCACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link