si:ch211-157m21.1

Ensembl ID:
ENSDARG00000039987
ZFIN ID:
ZDB-GENE-041014-354
Description:
human immunodeficiency virus type I enhancer binding protein 2 [Source:RefSeq peptide;Acc:NP_001025
Human Orthologue:
HIVEP2
Human Description:
human immunodeficiency virus type I enhancer binding protein 2 [Source:HGNC Symbol;Acc:4921]
Mouse Orthologue:
Hivep2
Mouse Description:
human immunodeficiency virus type I enhancer binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:13380

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43502 Nonsense Mutation detected in F1 DNA During 2017
sa17889 Nonsense Available for shipment Available now
sa32311 Nonsense Available for shipment Available now
sa23772 Nonsense Available for shipment Available now
sa37117 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058502 Nonsense 137 2323 1 6
ENSDART00000141734 Nonsense 137 2298 1 7
Genomic Location (Zv9):
Chromosome 20 (position 37546767)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37619280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGGTCTTTCTCTGGTCAACTGCAATCTCTGCCACCAGATGATATGTA[T/A]CCGGTACACTCCCGCTCTCATGGAGTATTTCCTCGTCATAAGTCTCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058502 Nonsense 219 2323 1 6
ENSDART00000141734 Nonsense 219 2298 1 7
Genomic Location (Zv9):
Chromosome 20 (position 37546522)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37619035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGTCCCACACAGGGGAGCGTCCTTATCCCTGTGTTCCATGTGGTTTCT[C/A]GTTCAAAACMAAGAGCAATTTGTATAAACATMGAAAATCGCATGCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058502 Nonsense 807 2323 1 6
ENSDART00000141734 Nonsense 807 2298 1 7
ENSDART00000058502 Nonsense 807 2323 1 6
ENSDART00000141734 Nonsense 807 2298 1 7
Genomic Location (Zv9):
Chromosome 20 (position 37544759)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37617272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACACGCTTTATCATATGCCCCACAAACTTGTACGTCAACCAAACATT[C/T]AAGTGCCTGAGATAAGAGTTACAGAAGAGCCTGACAAACCGGAAAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058502 Nonsense 807 2323 1 6
ENSDART00000141734 Nonsense 807 2298 1 7
ENSDART00000058502 Nonsense 807 2323 1 6
ENSDART00000141734 Nonsense 807 2298 1 7
Genomic Location (Zv9):
Chromosome 20 (position 37544759)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37617272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACACGCTTTATCATATGCCCCACAAACTTGTACGTCAACCAAACATT[C/T]AAGTGCCTGAGATAAGAGTTACAGAAGAGCCTGACAAACCGGAAAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058502 Nonsense 1772 2323 5 6
ENSDART00000141734 Nonsense 1772 2298 5 7
Genomic Location (Zv9):
Chromosome 20 (position 37540730)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 37613243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAATGTTTTTTTTTTCTTCTTTTCTCAGACACTACTGAGGAGGTTCAA[A/T]GAGGATCAGAGAAGAAGGGCATGTCAGAGATAATGGCAGAGCACCAGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link