ppt1

Ensembl ID:
ENSDARG00000039980
ZFIN ID:
ZDB-GENE-040426-2653
Description:
palmitoyl-protein thioesterase 1 [Source:RefSeq peptide;Acc:NP_998504]
Human Orthologue:
PPT1
Human Description:
palmitoyl-protein thioesterase 1 [Source:HGNC Symbol;Acc:9325]
Mouse Orthologue:
Ppt1
Mouse Description:
palmitoyl-protein thioesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1298204]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9 Nonsense Available for shipment Available now
sa23590 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058491 Nonsense 19 303 2 10
ENSDART00000142202   None 186 None 6

The following transcripts of ENSDARG00000039980 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44833557)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44154442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCGGCTGCTTTTCGTCTGTTGTCTGTCTCTGGATGTCTGCTGTTAT[T/A]GTGTGGCACATCATGGGCATCTAATGGCACAGTTCCTCTGGTGATTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058491 Nonsense 63 303 3 10
ENSDART00000142202   None 186 None 6

The following transcripts of ENSDARG00000039980 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 44834977)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44153022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATGGGTGCAATAAAGAAGATGGTGGAGCAGGAAGTCTCAGGAATATA[T/A]GTGCTTTCCCTCATGATCGGCAAATCTGTTTTTGAGGTAGAGCAGGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link