prom1a

Ensembl ID:
ENSDARG00000039966
ZFIN ID:
ZDB-GENE-030131-1577
Description:
Prominin-1-A [Source:UniProtKB/Swiss-Prot;Acc:Q9W735]
Human Orthologue:
PROM1
Human Description:
prominin 1 [Source:HGNC Symbol;Acc:9454]
Mouse Orthologue:
Prom1
Mouse Description:
prominin 1 Gene [Source:MGI Symbol;Acc:MGI:1100886]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24967 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6357 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11176 Essential Splice Site Available for shipment Available now
sa5611 Essential Splice Site F2 line generated During 2017
sa2762 Essential Splice Site F2 line generated During 2017
sa35759 Essential Splice Site Available for shipment Available now
sa42449 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35758 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105417 Essential Splice Site 377 856 9 26
ENSDART00000105418 Essential Splice Site 377 832 9 24

The following transcripts of ENSDARG00000039966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 49434849)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47512087
KASP Assay ID:
554-7745.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGACACTCCTGCTATGGTAACCGCTCAAACTCGAAATATTGTTGAAGG[T/C]AAGCTCACAGATTTAATTCTTTAAGCATATTTTGCTTCAGGGGCAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105417 Essential Splice Site 430 856 10 26
ENSDART00000105418 Essential Splice Site 430 832 10 24
ENSDART00000105417 Essential Splice Site 430 856 10 26
ENSDART00000105418 Essential Splice Site 430 832 10 24

The following transcripts of ENSDARG00000039966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 49434044)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47511282
KASP Assay ID:
554-5191.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRCAGATYGAGGACATCTACCCGCAGATYGATCAGATGGATTTCTACAGG[T/C]ACTTCTTCCGTTTATAAAAATGTAAYGTTTYTATAGCATATTWACTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105417 Essential Splice Site 430 856 10 26
ENSDART00000105418 Essential Splice Site 430 832 10 24
ENSDART00000105417 Essential Splice Site 430 856 10 26
ENSDART00000105418 Essential Splice Site 430 832 10 24

The following transcripts of ENSDARG00000039966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 49434044)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47511282
KASP Assay ID:
554-5191.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRCAGATYGAGGACATCTACCCGCAGATYGATCAGATGGATTTCTACAGG[T/C]ACTTCTTCCGTTTATAAAAATGTAAYGTTTYTATAGCATATTWACTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5611
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105417 Essential Splice Site 634 856 15 26
ENSDART00000105418 Essential Splice Site 634 832 15 24
ENSDART00000105417 Essential Splice Site 634 856 15 26
ENSDART00000105418 Essential Splice Site 634 832 15 24

The following transcripts of ENSDARG00000039966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 49419722)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47496960
KASP Assay ID:
554-3100.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWCTGAAACTGGCATTAATGAGATCGACTTTGCTGCCTATTTAGAGGAGG[T/C]ACAGTACATAACCTGCATAAACACACGCTCAGATTAAAACCTGGCACYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2762
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105417 Essential Splice Site 634 856 15 26
ENSDART00000105418 Essential Splice Site 634 832 15 24
ENSDART00000105417 Essential Splice Site 634 856 15 26
ENSDART00000105418 Essential Splice Site 634 832 15 24

The following transcripts of ENSDARG00000039966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 49419722)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47496960
KASP Assay ID:
554-3100.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWCTGAAACTGGCATTAATGAGATCGACTTTGCTGCCTATTTAGAGGAGG[T/C]ACAGTACATAACCTGCATAAACACACGCTCAGATTAAAACCTGGCACYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105417 Essential Splice Site 690 856 18 26
ENSDART00000105418 Essential Splice Site 690 832 18 24

The following transcripts of ENSDARG00000039966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 49413787)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47491025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGATCATTTGATGAGATTCTTGATTTTTTGTGTCTGTTTTTATTAA[A/T]GAGCACACTTAATCAGAGCATCAGACTTCTGGAAAGGACGTCCTCAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105417 Essential Splice Site None 856 24 26
ENSDART00000105418   None 832 None 24

The following transcripts of ENSDARG00000039966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 49397718)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47474956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCGACTGGTGACTCTCAGGACCACCATCTGCTTTTAACTACTGAAAG[G/A]TACCAAGAGCTGAAGATGAGCGCAAGCGGGTTTGATTCTCTCTAACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105417 Essential Splice Site None 856 25 26
ENSDART00000105418 Essential Splice Site 826 832 23 24

The following transcripts of ENSDARG00000039966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 49397245)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47474483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCGCAGCAGGTTTAATTCTGCAATGTTTGTTTCTTTACTCACGCA[G/A]CGATATTGGACACTGGAATTGAATCTTTGTGGAATGTAAGTTGCTTCAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link