FGFBP1 (1 of 2)

Ensembl ID:
ENSDARG00000039963
Description:
fibroblast growth factor binding protein 1 [Source:HGNC Symbol;Acc:19695]
Human Orthologue:
FGFBP1
Human Description:
fibroblast growth factor binding protein 1 [Source:HGNC Symbol;Acc:19695]
Mouse Orthologue:
Fgfbp1
Mouse Description:
fibroblast growth factor binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1096350]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7398 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058465 Missense 3 196 1 1
Genomic Location:
Chromosome 14 (position 49378014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGATTCACGCCGCAGTAGTTTGARAGTATTTCCAATGCAGCCATGATG[C/T]GCGCGACAGGCWTCGCTGTGTTTCTGGTGTTCGCCTGTGTCCTGCAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s17oxqfk