rspo1

Ensembl ID:
ENSDARG00000039957
ZFIN ID:
ZDB-GENE-040718-44
Description:
R-spondin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DHR0]
Human Orthologue:
RSPO1
Human Description:
R-spondin homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:21679]
Mouse Orthologue:
Rspo1
Mouse Description:
R-spondin homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:2183426]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12606 Essential Splice Site Available for shipment Available now
sa16889 Nonsense Available for shipment Available now
sa16782 Nonsense Available for shipment Available now
sa4672 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Essential Splice Site 32 261 2 6
Genomic Location:
Chromosome 16 (position 36119583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCACGCCGATAACCTCAAGGCCTCCAAAGCAAGAAGACAGAGACGGA[G/A]TGAGTGCTKATGTTTCTTTTTTGACAACTTTTCTCTTTTAGGTGGCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Nonsense 54 261 3 6
Genomic Location:
Chromosome 16 (position 36110180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCATCATGTTCGAATGGATGTGAACACTGCTCGGAGTACAACGGCTG[T/A]CTTAAATGTCGACCCCGACTCTTCATCTTACTGGAGCGAAATRATATCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Nonsense 85 261 3 6
Genomic Location:
Chromosome 16 (position 36110087)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RATATCCGTCAGATAGGCATTTGCCTGGCCGCGTGTCCTGTTGGATATTA[T/A]GGCATTCGAAAKCRGGATATGAACAAATGCACACGTAAGTCTTWGCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Nonsense 125 261 4 6
Genomic Location:
Chromosome 16 (position 36104220)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGAAACTTTTGCACAAAATGTAAGGAAGGCCTGTACTCGCWTAGAGGG[C/T]GATGTTTCTCCAGCTGTCCTGAAGGATTCACCGTCAACGGCACCATGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zn58rd0a