ENSDARG00000039951

Ensembl ID:
ENSDARG00000039951

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5113 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097651 Essential Splice Site 120 287 1 4
Genomic Location:
Chromosome 25 (position 36629623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCCACCGGGAGGGCTTCGACGTGGTGATGGAGGACYTGATTTTTAAAG[G/A]TAAAACACAGAGCTGTTTTTGTATGGGAACACATTACAATACGGGAGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ghq7wn2l