Q567Y1_DANRE

Ensembl ID:
ENSDARG00000039949
Description:
LOC553370 protein [Source:UniProtKB/TrEMBL;Acc:Q567Y1]
Human Orthologue:
FIBIN
Human Description:
fin bud initiation factor homolog (zebrafish) [Source:HGNC Symbol;Acc:33747]
Mouse Orthologue:
Fibin
Mouse Description:
fin bud initiation factor homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1914856]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13086 Nonsense Available for shipment Available now
sa12551 Nonsense Available for shipment Available now
sa19373 Nonsense Mutation detected in F1 DNA During 2017
sa12540 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
Genomic Location (Zv9):
Chromosome 25 (position 36590449)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34998065
KASP Assay ID:
554-5565.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGAAGCGAGAGATCGAGCAGATCGGCGARGCTTTCACMAACGTGGAG[A/T]AATCYCTGCTGGAGCTGGAGAGCAAGTTCAAGCAGAGCCAGGAGACGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
Genomic Location (Zv9):
Chromosome 25 (position 36590449)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34998065
KASP Assay ID:
554-5565.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGAAGCGAGAGATCGAGCAGATCGGCGARGCTTTCACMAACGTGGAG[A/T]AATCYCTGCTGGAGCTGGAGAGCAAGTTCAAGCAGAGCCAGGAGACGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
Genomic Location (Zv9):
Chromosome 25 (position 36590449)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34998065
KASP Assay ID:
554-5565.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGAAGCGAGAGATCGAGCAGATCGGCGAGGCTTTCACCAACGTGGAG[A/T]AATCTCTGCTGGAGCTGGAGAGCAAGTTCAAGCAGAGCCAGGAGACGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
ENSDART00000058443 Nonsense 149 225 1 1
Genomic Location (Zv9):
Chromosome 25 (position 36590449)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34998065
KASP Assay ID:
554-5565.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTGAAGCGAGAGATCGAGCAGATCGGCGARGCTTTCACMAACGTGGAG[A/T]AATCYCTGCTGGAGCTGGAGAGCAAGTTCAAGCAGAGCCAGGAGACGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link