LOC100330530

Ensembl ID:
ENSDARG00000039941
Human Orthologue:
OLFML2A
Human Description:
olfactomedin-like 2A [Source:HGNC Symbol;Acc:27270]
Mouse Orthologue:
Olfml2a
Mouse Description:
olfactomedin-like 2A Gene [Source:MGI Symbol;Acc:MGI:2444741]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39523 Essential Splice Site Mutation detected in F1 DNA During 2016
sa44431 Nonsense Mutation detected in F1 DNA During 2016
sa19382 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078436 Essential Splice Site 42 670 1 8
Genomic Location:
Chromosome Zv9_NA921 (position 67042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGGCGTGCTTGCTCATGATGTCCAGTCATGTTTCATCTCAGAGCAAG[G/T]TAAGAAAAAGTTCAAGATGAAAAACTAGCCTTGCATTCGTGCGCATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078436 Nonsense 228 670 4 8
Genomic Location:
Chromosome Zv9_NA921 (position 39337)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCTGCTGCAGAAAGACTCCTCCCCCTCGAGCCCTAAAAGCAAAGCA[C/T]AGGTAAAAATACTCAGACAAATAATTCACCAAATGAATGCAAAACTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078436 Nonsense 667 670 8 8
Genomic Location:
Chromosome Zv9_NA921 (position 15609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTTGGGACAATGGACACCAGCTCACCTACAACATCGACTTTGCAGAG[C/T]AGGAGAAGAAATAAAATCGTGCAAATGAAACGCGCTTATAACTGCCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link