si:ch1073-126c3.3

Ensembl ID:
ENSDARG00000039937
ZFIN ID:
ZDB-GENE-090313-1
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JME7]
Human Orthologue:
C10orf96
Human Description:
chromosome 10 open reading frame 96 [Source:HGNC Symbol;Acc:30524]
Mouse Orthologue:
1700011F14Rik
Mouse Description:
RIKEN cDNA 1700011F14 gene Gene [Source:MGI Symbol;Acc:MGI:1922895]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13967 Nonsense Available for shipment Available now
sa1052 Nonsense F2 line generated During 2017
sa35461 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081385 Nonsense 73 256 3 8
Genomic Location (Zv9):
Chromosome 13 (position 20665281)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 20395633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGCTSCTTTCYGAAGCCAGTCTGCAAGTTGATTTGATGACAAAACAA[C/T]GAGATCAACTGGAAAAACAGAAAGWGGAGCTCTTKGGCTTGCAGACGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1052
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081385 Nonsense 73 256 3 8
Genomic Location (Zv9):
Chromosome 13 (position 20665281)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 20395633
KASP Assay ID:
554-0955.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGCTGCTTTCTGAAGCCAGTCTGCAAGTTGATTTGATGACAAAACAA[C/T]GAGATCAACTGGAAAAACAGAAAGWGGAGCTCTTGGGCTTGCAGACGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081385 Essential Splice Site 94 256 3 8
Genomic Location (Zv9):
Chromosome 13 (position 20665348)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 20395700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGAAAGAGGAGCTCTTGGGCTTGCAGACGGAACTCAAAGACAATCTGG[T/A]ATACATAAACGCATTGCATATTGTTGGAGTTAATTGCCTCTCAGTCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link