GFRA1 (2 of 3)

Ensembl ID:
ENSDARG00000039936
Description:
GDNF family receptor alpha 1 [Source:HGNC Symbol;Acc:4243]
Human Orthologue:
GFRA1
Human Description:
GDNF family receptor alpha 1 [Source:HGNC Symbol;Acc:4243]
Mouse Orthologue:
Gfra1
Mouse Description:
glial cell line derived neurotrophic factor family receptor alpha 1 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22273 Nonsense Available for shipment Available now
sa8781 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058415 Nonsense 83 158 1 2
Genomic Location (Zv9):
Chromosome 13 (position 20624800)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 20326539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACACAGCTATGGCATGCTGTACTGCTCCTGTCCTCTAGGGGACCAGT[C/G]AGCCTGTTCTGAGCGCAGGCGCCAAACCATCGTGCCAGCTTGTTCATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058415 Nonsense 85 158 1 2
Genomic Location (Zv9):
Chromosome 13 (position 20624807)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 20326546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTATGGCATGCTGTACTGCTCCTGTCCTCTAGGGGACCARTCAGCCTG[T/A]TCTGAGCGCAGGCGCCAAACCATCGTGCCAGCTTGTTCATATGAGGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link