cyth4b

Ensembl ID:
ENSDARG00000039932
ZFIN ID:
ZDB-GENE-080219-45
Description:
cytohesin 4 [Source:RefSeq peptide;Acc:NP_001108375]
Human Orthologue:
CYTH4
Human Description:
cytohesin 4 [Source:HGNC Symbol;Acc:9505]
Mouse Orthologue:
Cyth4
Mouse Description:
cytohesin 4 Gene [Source:MGI Symbol;Acc:MGI:2441702]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3604 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028022 Essential Splice Site 53 394 3 13
Genomic Location:
Chromosome 6 (position 605235)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGAATGTGATGGCTGATATTCAGGACTTCAAGTCGGCAGAAGACAAG[T/C]GAGTCCAGCATCTCCTGGGGTGTTGTTGGTGTTGTTAGTGTTGTTTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uwkr36fi