cyth4b

Ensembl ID:
ENSDARG00000039932
ZFIN ID:
ZDB-GENE-080219-45
Description:
cytohesin 4 [Source:RefSeq peptide;Acc:NP_001108375]
Human Orthologue:
CYTH4
Human Description:
cytohesin 4 [Source:HGNC Symbol;Acc:9505]
Mouse Orthologue:
Cyth4
Mouse Description:
cytohesin 4 Gene [Source:MGI Symbol;Acc:MGI:2441702]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3604 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38532 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa3604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028022 Essential Splice Site 53 394 3 13
Genomic Location:
Chromosome 6 (position 605235)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGAATGTGATGGCTGATATTCAGGACTTCAAGTCGGCAGAAGACAAG[T/C]GAGTCCAGCATCTCCTGGGGTGTTGTTGGTGTTGTTAGTGTTGTTTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028022 Essential Splice Site 293 394 11 13
Genomic Location:
Chromosome 6 (position 593115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAATGTAGGTGTGTTTGTGGATCAGGGTTGATGACGGTGTGTGTGTTC[A/G]GGATAAAGAGCCACGCGGGATCATTCCTCTGGAGAATCTGTGTGTCAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link