ckmt2

Ensembl ID:
ENSDARG00000039929
ZFIN ID:
ZDB-GENE-040426-1654
Description:
creatine kinase S-type, mitochondrial [Source:RefSeq peptide;Acc:NP_956991]
Human Orthologue:
CKMT2
Human Description:
creatine kinase, mitochondrial 2 (sarcomeric) [Source:HGNC Symbol;Acc:1996]
Mouse Orthologue:
Ckmt2
Mouse Description:
creatine kinase, mitochondrial 2 Gene [Source:MGI Symbol;Acc:MGI:1923972]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9598 Splice Site, Nonsense Available for shipment Available now
sa5320 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048210 Splice Site, Nonsense 247 413 5 9
ENSDART00000055857 Splice Site, Nonsense 247 413 6 10
ENSDART00000058403 None None 413 None 10
Genomic Location:
Chromosome 5 (position 53456017)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCACCGCATCTGGTATGGCTAGAGATTGGCCAGATGCTCGTGGCATTT[G/A]GTAAGAACATGCAGTTAGAGCNNATCATTTCCCWATAGCAAATCCTTTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048210 Nonsense 335 413 8 9
ENSDART00000055857 Nonsense 335 413 9 10
ENSDART00000058403 Nonsense 335 413 9 10
Genomic Location:
Chromosome 5 (position 53461664)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGACTGATGATTGCCTTCATTTCAATGTTATATCCTTCTTAATAGGAC[A/T]AACGCTTCAATAAAATTTTGGACAATCTCAGGCTCCAGAAACGTGGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pgyyo9u6