rbm42

Ensembl ID:
ENSDARG00000039910
ZFIN ID:
ZDB-GENE-040809-2
Description:
RNA-binding protein 42 [Source:UniProtKB/Swiss-Prot;Acc:Q6DRG1]
Human Orthologue:
RBM42
Human Description:
RNA binding motif protein 42 [Source:HGNC Symbol;Acc:28117]
Mouse Orthologue:
Rbm42
Mouse Description:
RNA binding motif protein 42 Gene [Source:MGI Symbol;Acc:MGI:1915285]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22937 Nonsense Mutation detected in F1 DNA During 2014
sa10920 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058380 Nonsense 225 402 8 11
Genomic Location:
Chromosome 16 (position 47723581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAATGTGCACTTCTTCACAGGAGCAGTTGTCAGCACTGGTGGCAGAA[C/T]AGCAGGCTGCTGTCTTGGCCGCTGGGCTGCTGGAATCCAAGAAGGAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058380 Nonsense 336 402 10 11
Genomic Location:
Chromosome 16 (position 47719692)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAAGAGCRTTCAGCCGGTATCCGTCCTTCCTGAAGGCGAAGGTTGTT[C/T]GAGACAAACGCACTGGGAAAACGAAGGGTTACGGCTTYGTCAGTTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oeixfzw3