rbm42

Ensembl ID:
ENSDARG00000039910
ZFIN ID:
ZDB-GENE-040809-2
Description:
RNA-binding protein 42 [Source:UniProtKB/Swiss-Prot;Acc:Q6DRG1]
Human Orthologue:
RBM42
Human Description:
RNA binding motif protein 42 [Source:HGNC Symbol;Acc:28117]
Mouse Orthologue:
Rbm42
Mouse Description:
RNA binding motif protein 42 Gene [Source:MGI Symbol;Acc:MGI:1915285]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36247 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22937 Nonsense Available for shipment Available now
sa10920 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058380 Essential Splice Site 83 402 4 11
Genomic Location (Zv9):
Chromosome 16 (position 47732066)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44930262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGAGCTGCAACTTTAGTTGGTCCACCACCCACATTTGTTTGTCCTGG[T/C]AAAACATTTTTCAGTATTTACACTTTTAAACATTCCCATGTGGAAATCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22937
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058380 Nonsense 225 402 8 11
Genomic Location (Zv9):
Chromosome 16 (position 47723581)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44921777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAATGTGCACTTCTTCACAGGAGCAGTTGTCAGCACTGGTGGCAGAA[C/T]AGCAGGCTGCTGTCTTGGCCGCTGGGCTGCTGGAATCCAAGAAGGAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058380 Nonsense 336 402 10 11
Genomic Location (Zv9):
Chromosome 16 (position 47719692)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44917888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAAGAGCRTTCAGCCGGTATCCGTCCTTCCTGAAGGCGAAGGTTGTT[C/T]GAGACAAACGCACTGGGAAAACGAAGGGTTACGGCTTYGTCAGTTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link