NLRP6 (55 of 83)

Ensembl ID:
ENSDARG00000039900
Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44061 Nonsense Mutation detected in F1 DNA During 2017
sa44062 Splice Site Mutation detected in F1 DNA During 2017
sa32470 Nonsense Available for shipment Available now
sa32471 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058361 Nonsense 464 890 2 9
Genomic Location (Zv9):
Chromosome 23 (position 45272396)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45387437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCACTCCGTTGGATACCTCTCACAGCAGAGACGAGACTATTGAGTA[T/A]ATAAAAAGTAAAATCAGAGAAAATCCGTCTCCGGAGAGATCCATCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058361 Splice Site None 890 None 9
Genomic Location (Zv9):
Chromosome 23 (position 45272627)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45387206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTGCTGAACTCGACAAAGGACCTGGACGAGTTTGAGCTCAGGCAATA[C/A]GATTTTACAGAGGAGTGTCTTCTGAGGCTGCTACCGGTGGTCAAAGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058361 Nonsense 609 890 4 9
Genomic Location (Zv9):
Chromosome 23 (position 45274340)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45385493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGCGAGAACTGGACCTCAGTGAAAACAGGCTCCAGCTTTCAGGAATA[C/T]GACTTTTCTCTGCAGGACTGAAGAGCCCTAACTGTAAGCTGGAGATACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058361 Nonsense 853 890 8 9
Genomic Location (Zv9):
Chromosome 23 (position 45281538)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45378295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACCTAGGAGTGAACCTTTTGTCTTTTCTTCTGAAAAATCCACAATGT[A/T]AACTAGAGAAACTGGAGTGAGTGTACTCCACTTTATATTTCATTCATCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link