gnpnat1

Ensembl ID:
ENSDARG00000039892
ZFIN ID:
ZDB-GENE-050522-450
Description:
glucosamine 6-phosphate N-acetyltransferase [Source:RefSeq peptide;Acc:NP_001019545]
Human Orthologue:
GNPNAT1
Human Description:
glucosamine-phosphate N-acetyltransferase 1 [Source:HGNC Symbol;Acc:19980]
Mouse Orthologue:
Gnpnat1
Mouse Description:
glucosamine-phosphate N-acetyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1858963]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32139 Nonsense Available for shipment Available now
sa42894 Nonsense Mutation detected in F1 DNA During 2018
sa36360 Essential Splice Site Available for shipment Available now
sa36361 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25038 Missense, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058351 Nonsense 54 184 3 6
ENSDART00000131663 Nonsense 54 77 3 4
ENSDART00000138831 Nonsense 54 184 2 5
Genomic Location (Zv9):
Chromosome 17 (position 15057533)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15208361
GRCz11 17 15216294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTACTACATCAAATCAAAATGTTTTAATGGATTTTTTTAGGTTTCTA[C/A]AAGGTCTTAGCACAACTCACAGAGGCTGGAGATGTCACAGAAGAACAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058351 Nonsense 70 184 3 6
ENSDART00000131663 Nonsense 70 77 3 4
ENSDART00000138831 Nonsense 70 184 2 5
Genomic Location (Zv9):
Chromosome 17 (position 15057579)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15208407
GRCz11 17 15216340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACAAGGTCTTAGCACAACTCACAGAGGCTGGAGATGTCACAGAAGAA[C/T]AGTTTAAAGGTAATGCAAGATCATCATTTAGAAAAATACTCTCTCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058351 Essential Splice Site 73 184 4 6
ENSDART00000131663   None 77 None 4
ENSDART00000138831 Essential Splice Site 73 184 3 5
Genomic Location (Zv9):
Chromosome 17 (position 15058751)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15209579
GRCz11 17 15217512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAATAATAGTCTTTTATATAACCATCAAATGTTTATTTTTTATTAAA[G/A]CAAATTTTGAACATATGAAGAAATCTGGAGACTATTATGTGATAGTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058351 Essential Splice Site 115 184 4 6
ENSDART00000131663   None 77 None 4
ENSDART00000138831 Essential Splice Site 115 184 3 5
Genomic Location (Zv9):
Chromosome 17 (position 15058881)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15209709
GRCz11 17 15217642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGCAACACTAATCATAGAGCACAAATTCATCCACGCTTGTGCAAAGG[T/A]ACATTTTAAACATGTTTCAGCTTCATGTCAATGTTTTCATTGTGCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058351 Missense 138 184 6 6
ENSDART00000131663 Nonsense 74 77 4 4
ENSDART00000138831 Missense 138 184 5 5
Genomic Location (Zv9):
Chromosome 17 (position 15060133)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15210961
GRCz11 17 15218894
KASP Assay ID:
554-7553.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAAAGTAAAGGTTTAAACCATTGTTTTACTTTTGTTTTTTTAGGTTG[G/A]TATCAACACTGACCCTCCTCAGCAAAAAACTGCAGTGCTACAAGGTTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link