si:ch1073-329n19.2

Ensembl ID:
ENSDARG00000039887
ZFIN IDs:
ZDB-GENE-030131-6551, ZDB-GENE-050417-408, ZDB-GENE-100921-12
Description:
complement component 1 Q subcomponent-binding protein, mitochondrial [Source:RefSeq peptide;Acc:NP_
Human Orthologue:
C1QBP
Human Description:
complement component 1, q subcomponent binding protein [Source:HGNC Symbol;Acc:1243]
Mouse Orthologue:
C1qbp
Mouse Description:
complement component 1, q subcomponent binding protein Gene [Source:MGI Symbol;Acc:MGI:1194505]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31411 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058346 Essential Splice Site 147 270 None 6
ENSDART00000146840 Essential Splice Site 164 280 None 6

The following transcripts of ENSDARG00000039887 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 3941202)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3600480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCTGGAGGAAGAGCCCGAGCAGACACAGAAGAGTCAGGAGGAGGAGG[T/C]ATCACTCATACACACGGTTTACACATTACATTACTGTAGAGAAGAGATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link