LOC100003660

Ensembl ID:
ENSDARG00000039881
Human Orthologue:
KIAA1199
Human Description:
KIAA1199 [Source:HGNC Symbol;Acc:29213]
Mouse Orthologue:
9930013L23Rik
Mouse Description:
RIKEN cDNA 9930013L23 gene Gene [Source:MGI Symbol;Acc:MGI:2443629]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20866 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15558 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081346 Essential Splice Site 123 1012 4 21
Genomic Location:
Chromosome 7 (position 12081893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAAAAAAAACTCTAACAGCAGTGTGTGTTTGTGTTTGTGTGTTCTTC[A/C]GGCAAACCAGCTTACCTCCACATAGGAGAGGAGGTGGACGGTGTGGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081346 Nonsense 779 1012 16 21
Genomic Location:
Chromosome 7 (position 12141388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACGCAGAAAGAGAAGATGAGCCACAATCACCAGATCAGAGGATACTA[T/G]TACTGGGAGGAGGACACTGGGTGAGAGACCACRCCAGTAAAYGATGGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lg84mf76