AMBRA1 (2 of 2)

Ensembl ID:
ENSDARG00000039878
Description:
autophagy/beclin-1 regulator 1 [Source:HGNC Symbol;Acc:25990]
Human Orthologue:
AMBRA1
Human Description:
autophagy/beclin-1 regulator 1 [Source:HGNC Symbol;Acc:25990]
Mouse Orthologue:
Ambra1
Mouse Description:
autophagy/beclin 1 regulator 1 Gene [Source:MGI Symbol;Acc:MGI:2443564]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38008 Nonsense Mutation detected in F1 DNA During 2016
sa10816 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104686 Nonsense 327 1360 6 18
Genomic Location:
Chromosome 25 (position 8177377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCACACAGAATCCGACAGGCCTCCAGCCTTCAGATTCGACACAACCA[C/T]AAACTCAGTCGGGTCCCTCTGCCTTCTCGCCCGCTCCTAGTCAGACTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104686 Essential Splice Site 783 1360 8 18
Genomic Location:
Chromosome 25 (position 8172795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCCTCCGTGCCACCAGAGGCCAGTGATGGAGATTATGAAGACATCGA[G/A]TGAGTGTGACGATACTGACTTTATCTYAACTTCATGCTTCCGCACAGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link