AMBRA1 (2 of 2)

Ensembl ID:: ENSDARG00000039878
Description:: autophagy/beclin-1 regulator 1 [Source:HGNC Symbol;Acc:25990]
Human Orthologue:: AMBRA1
Human Description:: autophagy/beclin-1 regulator 1 [Source:HGNC Symbol;Acc:25990]
Mouse Orthologue:: Ambra1
Mouse Description:: autophagy/beclin 1 regulator 1 Gene [Source:MGI Symbol;Acc:MGI:2443564]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa10816	Essential Splice Site	Available for shipment	Available now

Mutation Details

Allele Name:: sa10816
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000104686	Essential Splice Site	783	1360	8	18

Genomic Location:: Chromosome 25 (position 8172795)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CCTTCCTCCGTGCCACCAGAGGCCAGTGATGGAGATTATGAAGACATCGA[G/A]TGAGTGTGACGATACTGACTTTATCTYAACTTCATGCTTCCGCACAGCTA
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Immunoglobulin A : Association of IFIH1 and other autoimmunity risk alleles with selective IgA deficiency. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for AMBRA1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: