
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
AMBRA1 (2 of 2)
- Ensembl ID:
- ENSDARG00000039878
- Description:
- autophagy/beclin-1 regulator 1 [Source:HGNC Symbol;Acc:25990]
- Human Orthologue:
- AMBRA1
- Human Description:
- autophagy/beclin-1 regulator 1 [Source:HGNC Symbol;Acc:25990]
- Mouse Orthologue:
- Ambra1
- Mouse Description:
- autophagy/beclin 1 regulator 1 Gene [Source:MGI Symbol;Acc:MGI:2443564]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38008 | Nonsense | Available for shipment | Available now |
sa10816 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa38008
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104686 | Nonsense | 327 | 1360 | 6 | 18 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8177377)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 7789901 GRCz11 25 7913993 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATTCACACAGAATCCGACAGGCCTCCAGCCTTCAGATTCGACACAACCA[C/T]AAACTCAGTCGGGTCCCTCTGCCTTCTCGCCCGCTCCTAGTCAGACTCGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10816
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104686 | Essential Splice Site | 783 | 1360 | 8 | 18 |
- Genomic Location (Zv9):
- Chromosome 25 (position 8172795)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 7785319 GRCz11 25 7909411 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTTCCTCCGTGCCACCAGAGGCCAGTGATGGAGATTATGAAGACATCGA[G/A]TGAGTGTGACGATACTGACTTTATCTYAACTTCATGCTTCCGCACAGCTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Immunoglobulin A : Association of IFIH1 and other autoimmunity risk alleles with selective IgA deficiency. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: