si:dkey-120e24.3

Ensembl ID:
ENSDARG00000039863
ZFIN IDs:
ZDB-GENE-080107-2, ZDB-GENE-091204-247
Description:
leukemia inhibitory factor receptor alpha b [Source:RefSeq peptide;Acc:NP_001107204]
Human Orthologue:
LIFR
Human Description:
leukemia inhibitory factor receptor alpha [Source:HGNC Symbol;Acc:6597]
Mouse Orthologue:
Lifr
Mouse Description:
leukemia inhibitory factor receptor Gene [Source:MGI Symbol;Acc:MGI:96788]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17514 Nonsense Available for shipment Available now
sa6671 Nonsense Mutation detected in F1 DNA During 2017
sa29572 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058306 Nonsense 19 960 1 17
ENSDART00000131890 Nonsense 19 951 2 18
Genomic Location (Zv9):
Chromosome 21 (position 20076426)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21211915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTCTGGCTATTGAGTGCTTTGCTTGTGTCTCTGATTGAGCTGGYAGAA[C/T]AGGATGGTGAGTCTTAGATGCATTTAATCAAAAATCATCACCACGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058306 Nonsense 322 960 7 17
ENSDART00000131890 Nonsense 322 951 8 18
Genomic Location (Zv9):
Chromosome 21 (position 20080594)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21216083
KASP Assay ID:
554-4930.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCATAATATATCCCATGCTGCTCATGCAAGAAATGCCACTGTTCACT[G/A]GAGTTGGAGTGTAACAGAATATGCTTCACTTCTAATGATTTGCCAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058306 Nonsense 407 960 9 17
ENSDART00000131890 Nonsense 398 951 10 18
Genomic Location (Zv9):
Chromosome 21 (position 20082420)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21217909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAATAATTTCTCTTCAGTTCCAGAACTGGTAGATGTTTGGATTCAATA[T/G]TCTGAAAACCACACATATATTCAATGGAAGGTACGTGCAATTTTGTATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link