bbs5

Ensembl ID:
ENSDARG00000039827
ZFIN ID:
ZDB-GENE-040426-1083
Description:
Bardet-Biedl syndrome 5 protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7ZWB7]
Human Orthologues:
BBS5, RP11-724O16.1
Human Description:
Bardet-Biedl syndrome 5 [Source:HGNC Symbol;Acc:970]
Mouse Orthologue:
Bbs5
Mouse Description:
Bardet-Biedl syndrome 5 (human) Gene [Source:MGI Symbol;Acc:MGI:1919819]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2513 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa2513
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058255 Essential Splice Site 301 342 10 12

The following transcripts of ENSDARG00000039827 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 49274175)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48589245
KASP Assay ID:
554-3187.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTGATGACGTGGAGATTGAGCCGGATGAGCACACGGATGCTTTTACTG[T/A]GARTTTTACCTCATGTGCTACTCTYAGAAATAATGACGCTCTGCTTTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link