ntlb

Ensembl ID:
ENSDARG00000039806
ZFIN ID:
ZDB-GENE-081028-48
Description:
Novel protein similar to murine T brachyury (T) [Source:UniProtKB/TrEMBL;Acc:B8JIX4]
Human Orthologue:
T
Human Description:
T, brachyury homolog (mouse) [Source:HGNC Symbol;Acc:11515]
Mouse Orthologue:
T
Mouse Description:
brachyury Gene [Source:MGI Symbol;Acc:MGI:98472]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42127 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31902 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058215 Essential Splice Site 188 411 4 8
Genomic Location (Zv9):
Chromosome 13 (position 4098871)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4315791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCCTTAATATAATTTCAAATAAATCTGTAATTTGTTCCTTATTTTC[A/T]GATTACGTCTCTCAAAATTAAATACAATCCATTCGCCAAAGCTTTTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31902
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058215 Essential Splice Site 331 411 8 8
Genomic Location (Zv9):
Chromosome 13 (position 4107856)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4324776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATGTTTTTAACCTGTGAATCCTCTGTTGTGTTTGTATCTTGTTTGCA[G/A]TCAGTACACCAGCTTGTGGTCTGTAGGGAACTCCTCTCAGTCTGGAAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association identifies the T gene as a novel asthma pharmacogenetic locus. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link