A0JMB2_DANRE

Ensembl ID:
ENSDARG00000039778
Description:
Zgc:152720 [Source:UniProtKB/TrEMBL;Acc:A0JMB2]
Human Orthologue:
NEDD4
Human Description:
neural precursor cell expressed, developmentally down-regulated 4 [Source:HGNC Symbol;Acc:7727]
Mouse Orthologue:
Nedd4
Mouse Description:
neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16624 Nonsense Available for shipment Available now
sa22392 Nonsense Mutation detected in F1 DNA During 2014
sa7381 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058161 Nonsense 207 787 9 25
Genomic Location:
Chromosome 13 (position 52174742)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCCTGCRCTGCCCCCTGGCTGGGAGGAGAGGCAGGACAACCTGGGA[C/T]GAACTTACTACGTCAACCACGAGAGCAGGACCACACAGTGGCACAGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058161 Nonsense 554 787 19 25
Genomic Location:
Chromosome 13 (position 52188809)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAAAAGCCTCTGTTGTGTGTCTGCAGGCAGAGATCCCGAATCGCTTC[G/T]AGCTGAGTGTGCGGCGTAACGCAGTGCTGGAGGACTCATACAGACGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058161 Missense 760 787 24 25
Genomic Location:
Chromosome 13 (position 52199184)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCTGGTGATGCAGTGGAGGTTTGTGGATCGCATACAAAGACAGATGA[C/T]GGCCTTTAAGGAGGTAAAGACAMMCATTCWGCCATTYGGGTCACTGTTRA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Brain connectivity: Genome-wide scan of healthy human connectome discovers SPON1 gene variant influencing dementia severity. (View Study)
  • Chronic lymphocytic leukemia: Common variants at 2q37.3, 8q24.21, 15q21.3 and 16q24.1 influence chronic lymphocytic leukemia risk. (View Study)
  • Keloid: A genome-wide association study identifies four susceptibility loci for keloid in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g6r3kwa8