dync2li1

Ensembl ID:
ENSDARG00000039770
ZFIN ID:
ZDB-GENE-040426-1230
Description:
Cytoplasmic dynein 2 light intermediate chain 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXY4]
Human Orthologue:
DYNC2LI1
Human Description:
dynein, cytoplasmic 2, light intermediate chain 1 [Source:HGNC Symbol;Acc:24595]
Mouse Orthologue:
Dync2li1
Mouse Description:
dynein cytoplasmic 2 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:1913996]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22241 Nonsense Available for shipment Available now
sa35430 Nonsense Available for shipment Available now
sa31909 Essential Splice Site Available for shipment Available now
sa6287 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42151 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Nonsense 141 358 6 13
Genomic Location (Zv9):
Chromosome 13 (position 10538941)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10841270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCTAAACCCAATGCGCTCTGGGAGACCATGGAAAGTCTGCTAGGAT[C/A]AGCTCGAAATCAGGTGGAAAAAGTGTGTGCCGCGCTGCAGAAGACAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Nonsense 168 358 6 13
Genomic Location (Zv9):
Chromosome 13 (position 10539021)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10841350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCGCTGCAGAAGACAGGAGAATCCAGATCTGGCAAACAACGAGTCCCA[C/T]GAGTCCTCCACAAGGACTATCCGGTACAGAGGATTACACCATTTCTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Essential Splice Site 198 358 7 13
Genomic Location (Zv9):
Chromosome 13 (position 10539194)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10841523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCCCTGTTCCTCTGCTCATAGTTGGGAGCAAGTTTGACATTTTTCAG[G/A]TAAAACTTCACTGACATGTTCATAGTAGTATGTACAGTGTGGTGATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Essential Splice Site 275 358 10 13
Genomic Location (Zv9):
Chromosome 13 (position 10541639)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10843968
KASP Assay ID:
554-4771.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAAACCTCTGGCTAKTCCAGCAGGATCAGACTCYCTRAGTCAAATCGG[T/A]AAGATACGTATKTTTTTGTTAAAGACAAACTAACTTTTATGCTTTTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Essential Splice Site 308 358 12 13
Genomic Location (Zv9):
Chromosome 13 (position 10543867)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10846196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGACAACCTTATAATAAATGTTCATCTGACCCTCCTATTTATTTTTTC[A/T]GAGCACAAGGGAGCGTAAAGAGCTGAAAGACCCTGTCAAAGACCCTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link