ldlrap1b

Ensembl ID:
ENSDARG00000039750
ZFIN ID:
ZDB-GENE-070112-1012
Description:
low density lipoprotein receptor adapter protein 1 [Source:RefSeq peptide;Acc:NP_001074104]
Human Orthologue:
LDLRAP1
Human Description:
low density lipoprotein receptor adaptor protein 1 [Source:HGNC Symbol;Acc:18640]
Mouse Orthologue:
Ldlrap1
Mouse Description:
low density lipoprotein receptor adaptor protein 1 Gene [Source:MGI Symbol;Acc:MGI:2140175]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35584 Nonsense Mutation detected in F1 DNA During 2017
sa31964 Essential Splice Site Available for shipment Available now
sa38970 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058093 Nonsense 43 229 1 7
Genomic Location (Zv9):
Chromosome 13 (position 46238863)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45491827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGGTGGAGGAACCCAAAGGAGAAGAGCTTTCAGCCGCTGCCGTCAAG[A/T]GAATCGTCGCTACTGTAAGACTCTGTACAGCAGCTCATCACACTGCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058093 Essential Splice Site 47 229 1 7
Genomic Location (Zv9):
Chromosome 13 (position 46238847)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45491811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGGAGAAGAGCTTTCAGCCGCTGCCGTCAAGAGAATCGTCGCTACTG[T/A]AAGACTCTGTACAGCAGCTCATCACACTGCACCCAGAGACACTATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058093 Essential Splice Site 178 229 5 7
Genomic Location (Zv9):
Chromosome 13 (position 46220985)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45473949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGCTCTCAGTCCGAGAGTTCAGCCAGTCTGAGCAGCATGAAAGGAG[G/A]TGAACACACACACACACACACACACACACACACTCACACACATACCTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link