asap1

Ensembl ID:
ENSDARG00000039729
ZFIN ID:
ZDB-GENE-091112-16
Human Orthologue:
ASAP1
Human Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 [Source:HGNC Symbol;Acc:2720]
Mouse Orthologue:
Asap1
Mouse Description:
ArfGAP with SH# domain, ankyrin repeat and PH domain1 Gene [Source:MGI Symbol;Acc:MGI:1342335]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30052 Nonsense Mutation detected in F1 DNA During 2015
sa24454 Essential Splice Site Mutation detected in F1 DNA During 2015
sa1723 Nonsense Confirmed mutation in F2 line During 2015

Mutation Details

Allele Name:
sa30052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030409 Nonsense 124 1156 4 30
ENSDART00000131204   None 350 None 8
ENSDART00000144372   None 223 None 4
ENSDART00000145466 Nonsense 123 1140 4 29

The following transcripts of ENSDARG00000039729 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 10743385)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCGGGATAATCCAGATCTGGGCACAGCCTTTGTTAAATTCTCCACTT[T/A]GACTAAAGAGCTTTCTGCCCTCCTCAAGAACCTGGTGAGTCCTCTATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030409 Essential Splice Site 337 1156 11 30
ENSDART00000131204   None 350 None 8
ENSDART00000144372   None 223 None 4
ENSDART00000145466 Essential Splice Site 336 1140 11 29

The following transcripts of ENSDARG00000039729 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 10719765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGTTTGGCTGTGAGAAGAAAGGCTATCTGTTAAAGAAGAGTGATGG[G/A]TACACGCATATACACACACTCAATTTTACATGTGGTTTCTGATCGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1723
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030409 Nonsense 991 1156 28 30
ENSDART00000131204 Nonsense 314 350 8 8
ENSDART00000144372 Nonsense 190 223 4 4
ENSDART00000145466 Nonsense 975 1140 27 29

The following transcripts of ENSDARG00000039729 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 10679627)
KASP Assay ID:
554-1669.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGCCTTCAGAATTACCACCTAAACCAGGAGAACTGCCTCCAAAGCCT[C/T]AACTGTCCGAACTTCCCCCTAAACCCCAGTTGGGTGACCTACCACCTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Multiple sclerosis: Genome-wide association study identifies new multiple sclerosis susceptibility loci on chromosomes 12 and 20. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w40xqo37