ENSDARG00000039716

Ensembl ID:
ENSDARG00000039716

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38202 Nonsense Mutation detected in F1 DNA During 2017
sa30469 Nonsense Mutation detected in F1 DNA During 2017
sa38201 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058053 Nonsense 244 710 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA629 (position 19389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGGAGAGAAACCTTACAAGTGTTCACACTGCGACAAGAGATTCAGA[C/T]AGTCATCACAATTGAAAATACATGAGAGGATTCACACTGGAGAGAAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058053 Nonsense 247 710 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA629 (position 19380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACCTTACAAGTGTTCACACTGCGACAAGAGATTCAGACAGTCATCA[C/T]AATTGAAAATACATGAGAGGATTCACACTGGAGAGAAACCGTACAAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058053 Nonsense 318 710 2 2
Genomic Location (Zv9):
Chromosome Zv9_NA629 (position 7645)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAAATCATAGAAAATACACACTCACTGAAGAGAAAAGGCAAAAAATG[C/A]TTCACCTGCACTCAGTGTGGAATAAGTCTAGCAACCAAACAAACTCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link