phlda1

Ensembl ID:
ENSDARG00000039714
ZFIN ID:
ZDB-GENE-041010-103
Description:
pleckstrin homology-like domain family A member 1 [Source:RefSeq peptide;Acc:NP_001006011]
Human Orthologue:
PHLDA1
Human Description:
pleckstrin homology-like domain, family A, member 1 [Source:HGNC Symbol;Acc:8933]
Mouse Orthologue:
Phlda1
Mouse Description:
pleckstrin homology-like domain, family A, member 1 Gene [Source:MGI Symbol;Acc:MGI:1096880]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20178 Nonsense Available for shipment Available now
sa12966 Nonsense Available for shipment Available now
sa33357 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058051 Nonsense 51 144 1 1
Genomic Location (Zv9):
Chromosome 4 (position 2211269)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1466810
KASP Assay ID:
2259-4343.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGGTGCTGCACCCGCACAAACACCACCATCAGCACCAACACCAGCAG[C/T]AGCACGACACCGGCTGCAAGGTGAAGGAGCTGCACTTCGCCAACATGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058051 Nonsense 78 144 1 1
Genomic Location (Zv9):
Chromosome 4 (position 2211186)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1466727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTCGCCAACATGAAGACGGTGGACTGCGTGGAGCGCAAGGGGAAGTA[T/A]GTGTACTTCACTGTGGTRATGTCCGAGGGCCGCGAGATCGACTTCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058051 Nonsense 137 144 1 1
Genomic Location (Zv9):
Chromosome 4 (position 2211011)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 1466552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCAAGTCGAGCCGGCAGAAGCAGCAGCAGTTGCTGGTGGTGTCCGCG[C/T]AGAAGATGGTGCGGAGCGCGCAGTAGGAGCCGGAGAACCTCGCTGGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link