cdc42ep4a

Ensembl ID:
ENSDARG00000039704
ZFIN ID:
ZDB-GENE-040704-22
Description:
CDC42 effector protein (Rho GTPase binding) 4a [Source:RefSeq peptide;Acc:NP_001002183]
Human Orthologue:
CDC42EP4
Human Description:
CDC42 effector protein (Rho GTPase binding) 4 [Source:HGNC Symbol;Acc:17147]
Mouse Orthologue:
Cdc42ep4
Mouse Description:
CDC42 effector protein (Rho GTPase binding) 4 Gene [Source:MGI Symbol;Acc:MGI:1929760]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1432 Nonsense Available for shipment Available now
sa3432 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058040 Nonsense 55 335 2 2
ENSDART00000148308 Nonsense 55 335 2 2
Genomic Location:
Chromosome 3 (position 47970734)
KASP Assay ID:
554-1360.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTAGGRCGCAGTGGAGAAGCTTTTGGAGATACCTCTTTCCTCAGCACT[C/T]GATCTGGAGAGCCACCCCAGGAGGGGCACACTTATCCTCGTTCTCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058040 Nonsense 311 335 2 2
ENSDART00000148308 Nonsense 311 335 2 2
Genomic Location:
Chromosome 3 (position 47971502)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGGAGAAACCAATCAGTGAGCCTTACGAGGAAGATATTGAAATTACT[G/T]AMAATGCCTGCAAACCAGWCAATGAACCAGCCTTCTCCTCCTTCATGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3297aors