SHOT1_DANRE

Ensembl ID:
ENSDARG00000039697
Description:
Shootin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0R8]
Human Orthologue:
KIAA1598
Human Description:
KIAA1598 [Source:HGNC Symbol;Acc:29319]
Mouse Orthologue:
4930506M07Rik
Mouse Description:
RIKEN cDNA 4930506M07 gene Gene [Source:MGI Symbol;Acc:MGI:1918903]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9054 Nonsense Mutation detected in F1 DNA During 2017
sa42914 Nonsense Mutation detected in F1 DNA During 2017
sa42913 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058027 Nonsense 86 544 4 17
ENSDART00000130377 Nonsense 124 582 5 18
Genomic Location (Zv9):
Chromosome 17 (position 21184468)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21334617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGAGAATTTAGAGATCGAGAAGACATGCAGAGAGAGCGTGGAGGCTT[T/A]GGCCTCAAAGGTGAGGGTTACTTTCTGTTTGTTTCCTTTGATTCTCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058027 Nonsense 278 544 9 17
ENSDART00000130377 Nonsense 316 582 10 18
Genomic Location (Zv9):
Chromosome 17 (position 21167793)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21317942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGAAAGCTCTGGCAGAAATCAGCACACTGACACACACTCTGGAGAAA[C/T]AGAGACTGGAGCATCAGCAACAGGTCACACACACACATTAATTCCCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058027 Nonsense 388 544 12 17
ENSDART00000130377 Nonsense 426 582 13 18
Genomic Location (Zv9):
Chromosome 17 (position 21161796)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21311945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCTTGTCTTTTATCTCTTACAGCTCATTGCTATCAATACTTCGTAAG[A/T]AAAAAGATGTGAGCACTGAAATCGCATTAGTGGAAAAAGACTCCTCTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major CVD: Framingham Heart Study 100K project: genome-wide associations for cardiovascular disease outcomes. (View Study)
  • Orofacial clefts: Genome-wide association study identifies two susceptibility loci for nonsyndromic cleft lip with or without cleft palate. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link