si:ch211-121a2.2

Ensembl ID:
ENSDARG00000039682
ZFIN ID:
ZDB-GENE-070705-21
Description:
hypothetical protein LOC564515 [Source:RefSeq peptide;Acc:NP_001098581]
Human Orthologues:
DUPD1, DUSP13
Human Descriptions:
dual specificity phosphatase 13 [Source:HGNC Symbol;Acc:19681]
dual specificity phosphatase and pro isomerase domain containing 1 [Source:HGNC Symbol;Acc:23481]
Mouse Orthologues:
Dupd1, Dusp13
Mouse Descriptions:
dual specificity phosphatase 13 Gene [Source:MGI Symbol;Acc:MGI:1351599]
dual specificity phosphatase and pro isomerase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43382 Nonsense Mutation detected in F1 DNA During 2017
sa39270 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023677 Nonsense 437 449 6 6
ENSDART00000140166   None 148 None 3
ENSDART00000145954 Nonsense 146 158 3 3

The following transcripts of ENSDARG00000039682 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 7245466)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7080859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACGTTTTAAAAGTGAGATGCATCTGGCCCAACTTGGGCTTCTTGAAA[C/T]AGCTGGCAGTTCTCAACTCAAAGCTTGCATGTCAGCAATAAACTATCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023677 Nonsense 448 449 6 6
ENSDART00000140166   None 148 None 3
ENSDART00000145954 Nonsense 157 158 3 3

The following transcripts of ENSDARG00000039682 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 7245433)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7080826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGGGCTTCTTGAAACAGCTGGCAGTTCTCAACTCAAAGCTTGCATGT[C/T]AGCAATAAACTATCCAGACAGGCATAACTGTAAAAAGCACAGGAAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link