samm50l

Ensembl ID:
ENSDARG00000039681
ZFIN ID:
ZDB-GENE-041114-30
Description:
Sorting and assembly machinery component 50 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q5U3I0]
Human Orthologue:
SAMM50
Human Description:
sorting and assembly machinery component 50 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24276]
Mouse Orthologue:
Samm50
Mouse Description:
sorting and assembly machinery component 50 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31377 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058007 Nonsense 162 469 6 15
Genomic Location (Zv9):
Chromosome 4 (position 8086651)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9015001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGGATTAAACTTCCAAACATGCTTGGCCGAGGAGAAAAGCTCACCTTT[C/T]AGTTTTCCTATGGAACTAAAGAGACGTCCTACGGCCTGTCATTCTTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link