dsc2l

Ensembl ID:
ENSDARG00000039677
ZFIN ID:
ZDB-GENE-031116-55
Description:
Dsc2l protein [Source:UniProtKB/TrEMBL;Acc:Q08BK3]
Human Orthologues:
DSC1, DSC2, DSC3
Human Descriptions:
desmocollin 1 [Source:HGNC Symbol;Acc:3035]
desmocollin 2 [Source:HGNC Symbol;Acc:3036]
desmocollin 3 [Source:HGNC Symbol;Acc:3037]
Mouse Orthologues:
Dsc1, Dsc2, Dsc3
Mouse Descriptions:
desmocollin 1 Gene [Source:MGI Symbol;Acc:MGI:109173]
desmocollin 2 Gene [Source:MGI Symbol;Acc:MGI:103221]
desmocollin 3 Gene [Source:MGI Symbol;Acc:MGI:1194993]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36971 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8668 Nonsense Mutation detected in F1 DNA During 2017
sa36970 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100060 Essential Splice Site 189 934 4 16
Genomic Location (Zv9):
Chromosome 20 (position 7462375)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7297768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGTTGTTGAGAATGCCAGTCCTCCTTTTCCAAAGGACGTCGAGATGG[T/C]GAGAAAGTAAAATAAATTGGTCTAAAGTGACCATGCTAGTGTGTGCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100060 Nonsense 531 934 11 16
Genomic Location (Zv9):
Chromosome 20 (position 7448698)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7284091
KASP Assay ID:
2261-3973.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTATACYATATKTTGAGTGCACTTTCTTATTTTTTGTTTGTAAGGTA[C/A]TATAAGTTGACTGACCCAGGCAATTGGATCACTGTGGTGGAGAGCACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100060 Nonsense 803 934 15 16
Genomic Location (Zv9):
Chromosome 20 (position 7442484)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 7277877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCAGAGCGCTGTTACGGAGAGCAAGAACGTGAATACAGCTCCTGGA[C/T]GATATGGACAGCAGTTTTTCCAGAGCGGCGGAGTTTACAACACCACCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link