dact1

Ensembl ID:
ENSDARG00000039675
ZFIN ID:
ZDB-GENE-040623-3
Description:
Dapper homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6QZN6]
Human Orthologue:
DACT1
Human Description:
dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) [Source:HGNC Symbol;Acc:17748]
Mouse Orthologue:
Dact1
Mouse Description:
dapper homolog 1, antagonist of beta-catenin (xenopus) Gene [Source:MGI Symbol;Acc:MGI:1891740]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12709 Nonsense Available for shipment Available now
sa23009 Nonsense Available for shipment Available now
sa23010 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058001 Nonsense 68 821 1 5
Genomic Location (Zv9):
Chromosome 17 (position 11023375)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10861311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGCTGGAGTACTTGAGGCAGAGGCAGGAGCTGCTGGTCAGGAGTGTGT[T/A]GAGCTGTCCAGAGGCTGCAGGACAAGACAAACCCTGCCTGACAGTGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058001 Nonsense 371 821 4 5
Genomic Location (Zv9):
Chromosome 17 (position 11030923)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10853763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAAGGCAGGCTAGTCTTTGTTCACGGGCTCCTGCTTCTGTTCAGGCC[C/T]AGCAATGGACCTCTGACCTTAAACCAAACTGGCAGACATGTTTACAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058001 Nonsense 544 821 4 5
Genomic Location (Zv9):
Chromosome 17 (position 11031442)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10853244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAGATGAGGGAGGTCCTCTGGTCAGTGCCCAGTATATTCCTGCTCAG[A/T]AACAGAACGTAAATCTTCAAAAGGGTGGCACCAAGAACATCAAGATTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link