alg14

Ensembl ID:
ENSDARG00000039671
ZFIN ID:
ZDB-GENE-041010-195
Description:
UDP-N-acetylglucosamine transferase subunit ALG14 homolog [Source:RefSeq peptide;Acc:NP_001006092]
Human Orthologue:
ALG14
Human Description:
asparagine-linked glycosylation 14 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28287]
Mouse Orthologue:
Alg14
Mouse Description:
asparagine-linked glycosylation 14 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914039]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8042 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057999 Nonsense 201 219 4 4

The following transcripts of ENSDARG00000039671 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 31343524)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCTGTCCGGGAAGATGCTCTACTACATTTCTGACTACTTCTTTGTG[C/T]AGTGGGCACAGCTCAAAGACAAATACCCAAATGCCATCTACATGGGAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)
  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8v125vzd