mrpl38

Ensembl ID:
ENSDARG00000039667
ZFIN ID:
ZDB-GENE-040426-2373
Description:
39S ribosomal protein L38, mitochondrial [Source:RefSeq peptide;Acc:NP_998110]
Human Orthologue:
MRPL38
Human Description:
mitochondrial ribosomal protein L38 [Source:HGNC Symbol;Acc:14033]
Mouse Orthologue:
Mrpl38
Mouse Description:
mitochondrial ribosomal protein L38 Gene [Source:MGI Symbol;Acc:MGI:1926269]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6275 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057983 Nonsense 227 345 7 9
Genomic Location:
Chromosome 12 (position 45986904)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCATCGGGAGATCAGATCTGCCCMTACTTATGTCCGTTCCCTGCCAGA[G/T]GAACAGGCCTGCACCGATTCATCTTCATTCTCTTCAAACAGGACGCACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8urj28al