ENSDARG00000039665

Ensembl ID:
ENSDARG00000039665
Human Orthologues:
DSG1, DSG2, DSG3, DSG4
Human Descriptions:
desmoglein 1 [Source:HGNC Symbol;Acc:3048]
desmoglein 2 [Source:HGNC Symbol;Acc:3049]
desmoglein 3 [Source:HGNC Symbol;Acc:3050]
desmoglein 4 [Source:HGNC Symbol;Acc:21307]
Mouse Orthologues:
Dsg1a, Dsg1b, Dsg1c, Dsg2, Dsg3, Dsg4
Mouse Descriptions:
desmoglein 1 alpha Gene [Source:MGI Symbol;Acc:MGI:94930]
desmoglein 1 beta Gene [Source:MGI Symbol;Acc:MGI:2664357]
desmoglein 1 gamma Gene [Source:MGI Symbol;Acc:MGI:2664358]
desmoglein 2 Gene [Source:MGI Symbol;Acc:MGI:1196466]
desmoglein 3 Gene [Source:MGI Symbol;Acc:MGI:99499]
desmoglein 4 Gene [Source:MGI Symbol;Acc:MGI:2661061]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3086 Nonsense F2 line generated During 2014
sa23638 Nonsense Available for shipment Available now
sa16750 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3086
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057981 Nonsense 130 1418 3 14
Genomic Location:
Chromosome 20 (position 7540134)
KASP Assay ID:
554-3322.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGGAATAAACGAGCGCCCTGTTGGTTGCTTCATGGTAGAAGAGTAC[A/T]AAGGATTAGTTCGCATCATACAGCCTCTGGATCGTGAAGAGAGGAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057981 Nonsense 328 1418 7 14
Genomic Location:
Chromosome 20 (position 7547764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTGAGGATCCAGGCACTGGATATTGATGAAGTACAAACAGACAATTG[G/A]TTGGCTGAGTTCACAATTGTGACAGGGAACGAAGATGGACATTTCAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057981 Nonsense 695 1418 11 14
Genomic Location:
Chromosome 20 (position 7549853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGCCTGCCCCACAGAGCAASTCCTCAATTTAGAGGTTTGCACATGCT[C/A]AGAAGGGGTGGGTTGTGGTTCAAAAATTGSAGAAGTTCATACAAGTTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0r5git34