A7YY95_DANRE

Ensembl ID:
ENSDARG00000039657
Description:
LOC100005699 protein [Source:UniProtKB/TrEMBL;Acc:A7YY95]
Human Orthologue:
FANK1
Human Description:
fibronectin type III and ankyrin repeat domains 1 [Source:HGNC Symbol;Acc:23527]
Mouse Orthologue:
Fank1
Mouse Description:
fibronectin type 3 and ankyrin repeat domains 1 Gene [Source:MGI Symbol;Acc:MGI:1914180]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6274 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6274
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057962 Essential Splice Site 157 362 4 11
Genomic Location:
Chromosome 12 (position 45869710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCRTCCTCAAGACTGATGAAGTGGAGCTCTGCCGAGTGCTGCAGTCTGG[G/T]TGAGTTTATTAACACTCAAATCAACATCTAAACCAACTTCACTCARGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lum915w8